Strains and mouse
Escherichia coli DE3 and L. lactis NZ9000 are maintained in this laboratory. E. coli DE3 was routinely cultured in Luria-Bertani (LB) medium at 37 °C, while NZ9000 was amplified and cultured in M17 medium supplemented with 0.5% glucose at 30 °C. H. pylori SS1 was cultured on 90 mm Columbia blood agar plate containing H. pylori additive (HB8646a, Qingdao Haibo) under microaerobic conditions for 2–3 days. The BALB/c male mice used in the experiments, aged 5–6 weeks, were purchased from Beijing Huafukang Biotechnology, and housed in a SPF experimental animal center. They were provided with a standard diet and drinking water. After one week of acclimatization, the relevant experiments were conducted.
Preparation of BLPs-SAM-FAdE
To obtain BLPs, we first washed the precipitated L. lactis obtained from amplification culture with sterile water, then re-suspended them in 0.1 M HCl and heated at 100 °C for 30 min to form the precipitate. Afterward, we washed the precipitate three times with sterile PBS and re-suspended it, adjusting the BLPs concentration to 1 U/mL for later use. To obtain the M cell-targeting recombinant protein SAM-FAdE, we first amplified the E. coli DE3 containing the pCZN1-SAM-FAdE plasmid, and when the OD600 reached 0.6–0.8, we induced expression for 4 h using 0.2 mM IPTG, followed by purification of the recombinant protein SAM-FAdE using a Ni column. To prepare the particle vaccine BLPs-SAM-FAdE, we mixed 1 U of BLPs with 80 µg of purified antigen SAM-FAdE at room temperature for 2 h, and then washed to remove unbound antigen.
SDS-PAGE and Western blot
Collect the bacterial cells after amplification and induction, the supernatant after ultrasonic disruption, and the bacterial cells for SAS-PAGE analysis of protein expression. Then, use the AKTA protein purification system (GE Healthcare, USA) to obtain SAM-FAdE. The concentration of the recombinant proteins SAM-FAdE is determined using a BCA protein assay kit and protein densitometry analysis. In brief, the obtained samples are mixed with loading buffer and denatured at 98 °C for 10 min. The proteins are then subjected to vertical electrophoresis at a constant current of 150 V for 1 h (Bio-Rad, USA). After staining with Bradford, the gel is decolorized until clear bands are visible. For Western blotting, the steps include membrane transfer, blocking, incubation with anti-His (Proteintech, China), and incubation with the secondary antibody. Finally, protein bands are analyzed using an exposure system.
Characteristic analysis of BLPs
To obtain qualified BLPs for the preparation of particulate vaccines, the morphology changes of the NZ9000, BLPs, and BLPs-SAM-FAdE were observed using a transmission electron microscope (HT7800, Japan). Meanwhile, the samples were diluted and analyzed for changes in particle size using a Malvern laser particle size analyzer (Mastersizer 2000, UK).
Binding of BLPs and purified antigens
Take 100 µL of BLPs and BLPs-SAM-FAdE respectively, incubate with FITC-labeled anti-His antibody for 2 h, then wash to collect the precipitate, re-suspend in 1 mL PBS and through the flow cytometer (C6, USA) to analyze its fluorescent expression. In addition, we also analyzed the binding of BLPs to purified antigens by indirect immunofluorescence. BLPs and BLPs-SAM-FAdE were evenly spread on lysine-treated slides, air-dried, and blocked with 3% BSA-PBS for 30 min. After washing twice with PBS, the slides were incubated with anti-FAdE mouse polyclonal antibody (1:100) prepared in our laboratory for 60 min at room temperature. After washing three times with PBS, the slides were incubated with FITC-labeled goat anti-mouse IgG (1:200, Proteintech, China) for 60 min in the dark. The slides were washed three times with PBS, and fluorescence was observed under a laser confocal microscope (ZEISS, Germany).
Construction and verification of M cell model
According to the method of Kerneis et al. [22], the M cell model was constructed using co-culture of Caco-2 cells and Raji B cells. We added 5 × 105 Caco-2 cells to a 3 μm Transwell chamber, changed the medium every other day, and collected the culture medium in the upper chamber for later use until they were fully differentiated (14 days). Next, Raji B cells (105) were added to the basolateral side of the Transwell chamber and cultured for 4 days. At the same time, no Raji B cells were added as a control. Order to verify whether the M cell model was successfully constructed [23], the membrane of the Transwell chamber was first observed using a scanning electron microscope (S-3400 N, Japan). At the same time, the changes in ALP activity on days 4, 8, 12, 14, 16, 18, and 20 were analyzed using an alkaline phosphatase (ALP) detection kit (Beyotime, China).
After successfully constructing the model, we validated the M cell targeting of BLPs-SAM-FAdE in vitro by adding green fluorescently labeled BLPs-SAM-FAdE and BLPs to both mono-culture and co-culture systems and incubating them in the dark for 6 h. After washing, 1 mL of 4% paraformaldehyde was added to fixation, and targeting was observed using a fluorescence microscope (OLYMPUS, Japan). Additionally, we validated the targeting of the particulate vaccine in vivo using an ileal loop experiment. After thoroughly cleaning a segment of the mouse ileum, one end was tightly tied off, and BLPs-SAM-FAdE and FAdE were separately infused from the other end before being sealed. After a 6-hour reaction, the tissue was frozen and sectioned. BLPs-SAM-FAdE and FAdE were identified using Alexa Fluor®647-labeled anti-His antibodies, while FITC-labeled GP2 antibodies were used to identify PPs M cells. Finally, the fluorescent signals were observed using a confocal microscope (ZEISS, Germany).
Finally, we analyzed the biological distribution of the BLPs-SAM-FAdE vaccine using in vivo imaging system (IVIS). Six-week-old BALB/c mice were fasted with water and food for 24 h and then gavaged with specific volumes of AlexFluor®488-FAdE and AlexFluor®488-BLPs-SAM-FAdE, respectively. After 24 h of free movement, the mice were euthanized, and the stomach and intestinal tissues were dissected separately to observe the fluorescence distribution using IVIS (IVIS Lumina III, USA).
Immunization and sample collection
As shown in Fig. 1A, to evaluate the effect of BLPs-SAM-FAdE in clearing H. pylori, 24 male BALB/c mice aged 6–8 weeks were randomly divided into 4 groups (6 mice per group). One group was given normal drinking water as a control (Control group), while the other three groups were gavage with a H. pylori suspension (1 × 109 CFUs/mL) at 300 µL per mouse every other day, for a total of 4 gavage sessions to establish an H. pylori mouse infection model. To verify the successful construction of the model, we randomly took the stomach tissues of 2 mice at the 4th week after the final infection, and used the rapid urease detection assay, H. pylori colony formation assay, and RT-qPCR to verify whether the mice were successfully infected with H. pylori. One month after the gavage, the three groups of mice were respectively gavage with PBS (H. pylori group), a combination antibiotic treatment (metronidazole + amoxicillin + omeprazole, Antibiotics group), and BLPs-SAM-FAdE (1 U BLPs with 80 µg antigen, BLPs-SAM-FAdE group) once a week, and the treatment was continued for 4 weeks. Ten days after the last immunization, the gastric tissues of the mice were collected to evaluate the effect of H. pylori clearance.
(A) Schematic diagram of time points of BLPs-SAM-FAdE treatment of H. pylori (Hp) infection model; (B) RT-qPCR detects expression of H. pylori 16S rRNA in gastric tissue; (C) H. pylori quantitative culture statistical chart; (D) Stomach statistical chart of gastritis score of HE staining; (E) HE staining of gastric tissue (×200)
Furthermore, to investigate the specific mechanism by which BLPs-SAM-FAdE induces an immune response, healthy male BALB/c mice aged 6–8 weeks were randomly divided into 4 groups and gavage with PBS, BLPs (1 U), the monovalent antigen SAM-FAdE (80 µg), and BLPs-SAM-FAdE (1 U BLPs with 80 µg antigen) once a week for 4 consecutive weeks. In the sixth week, gastrointestinal lavage fluid and feces were collected to evaluate the production of antigen-specific sIgA. Blood was collected via the orbital vein to separate serum for detecting antigen-specific IgG and subtype. Additionally, spleens and lymph nodes were collected to isolate lymphocytes for analyzing the activation of germinal centers, plasma cells, and T cell responses induced by the BLPs-SAM-FAdE.
Ability of BLPs-SAM-FAdE to activate BMDCs in vitro
BMDCs were obtained from the femurs and tibias of 8-week-old BALB/c mice and cultured in RPMI 1640 medium containing 5% FBS, 1% antibiotics, 20 ng/mL GM-CSF, and 20 ng/mL IL-4 for 7 days, with medium changes on days 3 and 6. To evaluate the induction capability of BLPs-SAM-FAdE on BMDCs, the BMDCs were seeded at a density of 1 × 105 cells per well and co-cultured with BLPs, SAM-FAdE single antigen, and BLPs-SAM-FAdE for 24 h. BMDCs treated with LPS served as a positive control, and untreated BMDCs served as a negative control. Finally, the cells were collected and incubated with PE anti-mouse CD11c, FITC anti-mouse MHC II, APC anti-mouse CD40, Super Bright™ 436 anti-mouse CD80, and Super Bright™ 600 anti-mouse CD86 (Invitrogen) monoclonal antibodies for 40 min. The expression of surface markers or co-stimulatory molecules was detected using flow cytometry. Additionally, the secretion of IL-1β, IL-12p70, IL-4, and IL-6 in the supernatant was measured using an ELISA kit (Fine Test®, China) according to the manufacturer’s instructions.
FAdE-specific IgG, IgG1, IgG2a and sIgA ELISA
In summary, 100 µL of SAM-FAdE antigen coating solution was added to each well of the ELISA plate at a final concentration of 2 µg/mL and incubated overnight at 4 °C. The next day, the plate was washed twice and blocked with 5% BSA-PBS for 2 h, followed by four washes before adding samples. Gradients of diluted serum or samples such as gastrointestinal lavage fluid and feces were added to the ELISA plate and incubated for 1 h, followed by three washes and subsequent incubation with HRP-conjugated sheep anti-mouse IgG, IgG1, IgG2a, and sIgA (Abcam, USA) for 1 h. After incubation, the ELISA plate was washed 3–4 times and developed with 100 µL TMB for 30 min. Finally, 50 µL of 2 M H2SO4 was added to stop the reaction, and the absorbance was measured at 450 nm.
FAdE-specific IFN-γ/IL-4/IL-17 T-cell
To assess the induction of FAdE-specific CD4+ T cell responses following oral immunization, splenocytes were extracted from mice and stimulated with SAM-FAdE. The cells were then collected for intracellular cytokine staining, using the following antibodies: BV421-anti mouse CD3, FITC-anti mouse CD4, PE-anti mouse IFN-γ, Percp cy5.5-anti mouse IL-4, and APC-anti mouse IL-17A (Biolegend). Additionally, cytokine secretion levels of IFN-γ, IL-4, and IL-17A in the supernatant were measured using an ELISA kit (Fine Test®, China). Furthermore, we evaluated the activation levels of Th1, Th2, and Th17 corresponding to the secretion of IFN-γ, IL-4, and IL-17A using the ELISPOT assay according to the manufacturer’s instructions (Mabtech).
GC B cell and plasma cell staining
The mesenteric lymph nodes (MLN) of mice were immersed in sterile PBS, mechanically ground, and filtered through a 200-mesh filter to remove debris. The activation ratios of germinal center B cells and plasma cells were evaluated using the following antibodies: FITC-anti mouse CD45R/B220 (Invitrogen), PE-anti mouse CD95 (Fas), APC-anti mouse GL-7, and BV421-anti mouse CD138 (Biolegend). Samples were analyzed using a FACS Celesta flow cytometer (BD, USA) and data were processed with FlowJo 10.8.1 software. The activation status of germinal centers in the spleen was assessed through tissue immunofluorescence analysis. Stomach tissues from mice orally administered PBS, BLPs, SAM-FAdE, and BLPs-SAM-FAdE were embedded, sectioned into 10 μm thick slices, fixed, and blocked, then stained with the following antibodies: BV510-anti mouse CD4 (BD Biosciences), FITC-anti mouse B220 (Invitrogen), and Rhodamine-PNA (Vector). After mounting, observations were made using a confocal microscope (ZEISS, Germany).
Effects of BLPs-SAM-FAdE treatment on H. pylori infection
10 days after the final immunization, mouse gastric tissues were isolated and divided into three parts: one part was used for quantitative culture of H. pylori [24], another for RT-qPCR detection of H. pylori-specific 16S rRNA expression, and the last part for histopathological analysis. The primer sequences used were as follows: H. pylori 16S rRNA (Forward: CTCATTGCGAAGGCGACCT, Reverse: TCTAATCCTGTTTGCTCCCCA) and internal control 18S rRNA (Forward: GCAATTATTCCCCATGAACG, Reverse: GGCCTCACTAAACCATCCAA). According to quantitative culture of H. pylori, the gastric tissue was homogenized in 0.5 mL of PBS. After diluting it in the following ratios: 1:10, 1:100, and 1:1000, 100 µL was plated onto 90 mm Columbia blood agar plate containing H. pylori additive under microaerobic conditions for 2–3 days prior to a colony count being conducted. The colony-forming units per gram of stomach tissue (CFU/g): H. pylori colonization density was equal to bacteria colony count × dilution / gastric weight. For HE staining, gastric tissues were fixed in 10% formaldehyde, dehydrated through a graded ethanol series, embedded in paraffin, sectioned, and stained with hematoxylin-eosin for microscopic observation. The pathological scoring of gastric mucosal damage was based on the following scoring criteria Table 1 [25].
Statistical analysis
Unless otherwise specified, data are shown as the mean ± SD and each experiment was repeated two or three times. Data were analyzed by the two-tailed unpaired t-test or one-way ANOVA with Tukey’s post hoc analysis using GraphPad Prism.
Discover more from TrendyShopToBuy
Subscribe to get the latest posts sent to your email.
